Bio 181

Spring, 2001

Cloning Antibody cDNAs:

DNA Sequence Analysis

In this series of labs we have been attempting to clone antibody cDNAs using RT-PCR. To review the RT-PCR steps and to obtain the primer sequences see Cloning Antibody cDNAs Part 2: RT-PCR. A couple of key points to remember from this.

1. Primer design is critical. We opted to design non-degenerate primers based on the assumption that we have a good idea of what our target sequence is. Primer design was discussed in class--remember that there are other options here, such as using degenerate primers.

2. RT-PCR conditions are critical. In particular, the choice of annealing temperatures during PCR is very important for success. We opted to carry out annealing somewhat below the Tm of our primers. This was done at some risk. The lower Tm allows some mismatch during annealing--this could be critical for success if we had one or several mismatches between our primer and the target sequence. This is a trade-off with the risk that we will allow enough mismatch to amplify a similar sequence that, either through evolutionary relatedness or chance, has sequence similarity with our target.

 

Most of you had successful RT-PCR reactions, that is, some product was amplified. The first step in determining whether the correct product was generated is to examine the sizes of the products on a gel and compare these to the predicted target size.

What size product did you predict? Did your product(s) match the predicted size.

 

In our pre-run of the lab a predominant product of about 1,100 bp was generated. This is smaller than we would predict for a nearly full-length heavy chain cDNA. (We expect to amplify a nearly full-length cDNA since the upstream primer is at the translational start site and the downstream primer is in the 3' UTR.) It is this 1,100 bp product that was sent out for sequencing. Some groups also amplified a larger fragment that is closer to the predicted size. We did not sequence this yet but will shortly! Let's continue our analysis with the 1,100 bp product we did sequence.

I've copied the sequence below. This was generated by direct sequencing of gel-purified PCR product using the upstream primer (MmIgG2ahf).

Analysis:

1. Is this a heavy chain cDNA? How could you answer this? Think BLAST.

 

2. Now, hopefully you've found the mouse cDNA that matches this sequence exactly.

a. What is it?

 

b. Can you locate the sequences that we apparently primed from in our PCR? This requires some thought regarding how sequencing reactions are run and how the PCR proceeds. Remember, the PCR product was about 1,100 bp long and the PCR was primed with primer MmIgG2ahf: 5' ATGGAAAGGCACTGGATCTTTC 3' (upstream) and MmIgG2ahr2: 5' TGGGTGCTTTATTTATACAAGG 3' (downstream).

 

c. Having found both primer sites (they are both there) now determine how big the PCR amplified fragment actually was. How does this compare with what you determined comparing your product to lambda standards?

 

3. Does the product we have amplified show similarity with our target sequence over a larger region than just the primers we chose?

 

4. How could we modify our RT-PCR to improve our chances of amplifying the correct product?

 

5. The larger product amplified by some groups may well be the correct product. The third primer (MmIgG2ahr2) we designed for this lab lies just internal to the downstream primer MmIgG2ahr2. How could this third primer be used to test whether the larger product is likely correct?

 

 

Sequencing results:

GCCAATGGGAAAATCTTGGATTATGAAGTGATTCTTACGCAGTCAAAGTCCGTCTCACAAACGTACAC

AGTCACTGGCACAGAGCTGACCGTGAATCTCACCAATGACCGCTATGTCGCGTCTCTAGCAGCAAGAA

ACAAGGTGGGCAAATCAGCTGCAGCTGTCCTCACCATCCCCAGCCCCCACGTCACAGCTGCTTATTCT

GTAGTGAATCTTAAAGCATTTCCAAAAGATAACCTGCTCTGGGTGGAATGGACACCTCCACCTAAACC

CGTGAGCAAGTACATCTTAGAGTGGTGTGTGTTGTCAGAGAACGCACCCTGTGTTGAAGACTGGCAGCA

GGAAGACGCTACCGTGAATCGGACCCACTTGAGAGGACGCCTCCTGGAGAGCAAGTGCTATCAAATCA

CAGTAACTCCCGTATTCGCCACGGGGCCCGGAGGCTCTGAGTCCTTGAAGGCGTACCTCAAACAAGCC

GCTCCTGCCAGAGGACCGACTGTTCGGACAAAGAAAGTGGGGAAAAATGAAGCTGTCTTAGCGTGGGA

CCAGATTCCTGTGGACGACCAGAATGGCTTCATTAGAAACTACTCCATATNTTACAGAACCCAGCGTGGGN

 

May 13, 2001